Makalah Identifikasi Bakteri Dengan Molekuler (PCR) – Kelompok 10-2018B

Makalah Identifikasi Bakteri Dengan Molekuler (PCR) - Kelompok 10-2018B
  • Makalah Identifikasi Bakteri Dengan Molekuler (PCR) – Kelompok 10-2018B

  • Views 4

  • Downloads 0

  • File size 2MB
  • Author/Uploader: yulius ontaha

MAKALAH BAKTERIOLOGI III (Penerapan Metode Molekuler dalam Identifikasi Bakteri)

Disusun Oleh Kelompok X: 2018 B Yulius Ontaha

:18 3145 353 061

Nur Syafah Samal

:18 3145 353 071

Ananda Sakiyya S

:18 3145 353 050

Irma Suryani Marzuki

:18 3145 353 082

PROGRAM STUDI DIV TEKNOLOGI LABORATORIUM MEDIS FAKULTAS TEKNOLOGI KESEHATAN UNIVERSITAS MEGAREZKY MAKASSAR 2020

KATA PENGANTAR Puji syukur kehadirat Allah SWT yang telah memberikan rahmat dan hidayahNya sehingga kami dapat menyelesaikan makalah ini tepat pada waktunya. Adapun tujuan dari penulisan makalah ini adalah untuk memenuhi tugas pada mata kuliah “Bakteriologi III”. Selain itu juga bertujuan untuk menambah wawasan tentang Penerapan metode molekuler dalam identfikasi bakteri bagi para pembaca dan bagi kami selaku penulis. Kami pun menyadari bahwa didalam makalah yang telah kami buat ini masih jauh dari kata sempurna baik segi penyusunan, bahasa, maupun penulisannya. Oleh karena itu, kami mengharapkan kritik dan saran yang membangun dari para pembaca guna menjadi acuan agar kami selaku penulis bisa menjadi lebih baik di masa mendatang.

Makassar, 06 Juni 2020 Penyusun Kelompok X

i

DAFTAR TABEL Tabel 1. Jenis Jenis DNA Polimerase yang Sudah ada di Pasar dan digunakan dalam Biologi Molekuler dan Karakteristiknya Tabel 2. Metode Metode PCR Terkini dan digunakan sebagai tools

ii

DAFTAR GAMBAR Gambar 1. Siklus PCR Gambar 2. Metode Elektroforesis Gambar 3. Hasil pemeriksaan LAMP-TB menggunakan sinar fluoresens

iii

DAFTAR LAMPIRAN Lampiran Journal 1 Lampiran Journal 2 Lampiran Journal 3 Lampiran Journal 4 Lampiran Journal 5 Lampiran Journal 6 Lampiran Journal 7 Lampiran Journal 8 Lampiran Journal 9 Lampiran Journal 10

iv

DAFTAR ISI Sampul ………………………………………………………………………………………….. Kata Pengantar ………………………………………………………………………………..

i

Daftar Tabel …………………………………………………………………………………….

ii

Daftar Gambar …………………………………………………………………………………

iii

Daftar Lampiran ……………………………………………………………………………….

iv

Daftar Isi …………………………………………………………………………………………

v

BAB I Pendahuluan ………………………………………………………………………….

1

I.1 Latar Belakang ………………………………………………………………………

1

I.2 Tujuan ………………………………………………………………………………….

3

I.3 Manfaat ………………………………………………………………………………..

3

BAB II Pembahasan …………………………………………………………………………

4

II. 1 Definisi PCR ………………………………………………………………………..

4

II. 2 Perkembangan Teknologi PCR ………………………………………………

4

II. 3 Komponen PCR …………………………………………………………………..

6

II. 4 Tahapan Proses PCR ……………………………………………………………

7

II. 5 Kelebihan dan Kekurangan Metode PCR ………………………………….

9

II. 6 Jenis-jenis PCR …………………………………………………………………..

10

II. 7 Optimasi PCR ……………………………………………………………………..

11

II. 8 Metode Kerja ……………………………………………………………………….

14

BAB III Penutup ……………………………………………………………………………….

20

III. 1 Kesimpulan ………………………………………………………………………..

20

III. 2 Saran ………………………………………………………………………………..

20

Daftar Pustaka …………………………………………………………………………………

21

v

BAB I PENDAHULUAN I.1 Latar Belakang Istilah Biologi Molekuler pertama kali dikemuka oleh Wiliam Astbury pada tahun 1945, dengan pengertian ilmu yang mempelajari fungsi dan organisasi jasad hidup (organisme) ditinjau dari struktur dan regulasi molekuler unsure atau komponen penyusunnya. Biologi molekuler cabang ilmu pengetahuan yang mempelajari hubungan antara struktur dan fungsi molekul-molekul hayati, serta kontribusi hubungan tersebut terhadap pelaksaan dan pengendalian berbagi proses biokimia (Azmi, 2016) Biologi molekuler merupakan ilmu pengetahuan multi disiplin ilmu dari 1 biokimia, biologisel, dan genetika yang mempelajari aktivitas biologi pada level molekuler, termasuk interaksi antara perbedaan tipe DNA, RNA, protein, dan biosintesisnya. Aktivitas atau mekanisme apa yang terjadi pada level molekuler sangat penting untuk dipelajai sehingga dapat menunjukkan gen apa yang mempengaruhi suatu penyakit genetic, identifikasi gen, identifikasi DNA, identifikasi DNA forensic, terapi gen dalam megobati, dan mencegah penyakit dan sebagianya. Saat ini ilmu dan teknologi mengenai biologi molekuler berkembang sangat pesat, sudah banyak penelitian-penelitian Indonesia yang dikirim sekolah keluar negeri untuk mempelajari bidang Biologi Molekuler (Ivan, 2011). Saat ini identifikasi mikroorganisme secara molekuler telah menjadi metode utama untuk mempelajari keanekaragaman mikroorganisme. Sejak diperkenalkan pertama kali pada tahun 1990 hingga saat ini telah banyak mikroorganisme baru yang berhasil di identifikasi baik yang dapat dikultur (culturable) maupun yang belum dapat dikultur (Unculturable) yang terbagi kedalam tiga kelompok besar yaitu bakteri, archea, dan eukariot. Beberapa tahun terakir ini telah dilakukan identifikasi mikroba secara molekuler dengan tersedianya alat thermocygle PCR (Gintung dan Yusro. 2009). Reaksi polymerase berantai atau dikenal sebagai polymerase Chain Reaction (PCR), merupakan suatu proses sintesis enzimatik untuk melipatgandakan suatu sekuens nukleotida tertentu secara in vitro. Metode ini dikembangkan pertama kali oleh Kary B. Mulis pada tahun 1985. Metode ini sekarang telah banyak digunakan

1

untuk berbagai macam manipulasi dan analisis genetic. Pada awal digunakan untuk melipatgandakan molekul DNA, tetapi kemudian dikembangkan lebih lanjut sehingga dapat digunakan pula untuk melipatgandakan dan melakukan kuantitas molekul Mrna. Dengan menggunakan metode PCR dapat meningkatkan jumlah urutan DNA ribuan bahkan jutaan kali dari jumlah semula, sekitar 106-107 kali. Setiap urutan basa nukleotida yang diamplifikasi akan menjadi dua kali jumlahnya. Pada setiap siklus PCR akan diperoleh 2n kali banyaknya DNA target. Kunci utama pengembangan PCR adalah menemukan bagaimana cara amplifikasi hanya pada urutan DNA target dan meminimalkan amplifikasi non-target (Elliwati, 2015) Begitu banyak mikroorganisme dalam hidup kita yang tanpa kita sadari selalu ada dilingkungan kita. Salah satu mikroorganisme yang selalu ada di sekitar kita adalah bakteri. Bakteri memiliki bentuk dan jenis yang beragam, begitu pula dengan habitat atau tempat hidupnya. Ada bakteri yang hidup di air, tanah, udara, dan ada pula yang hidup dalam makanan kita. Bakteri-bakteri tersebut bisa saja menguntungkan, tapi banyak pula yang merugikan. Dapat merugikan bakteri salah satunya adalah bakteri dapat menyebabkan penyakit dan bahkan kematian. Namun, sejumlah bakteri dapat memberi manfaat bagi kehidupan manusia, misalnya dalam proses pembuatan antibiotik, vaksin, asam amino, vitamin, enzim dan steroid. Semuanya dimanfaatkan untuk meningkatkan kesehatan masyarakat (Kuswiyanto, 2015). Penyakit tuberkulosis (TB) masih merupakan masalah utama kesehatan masyarakat di Indonesia. Indonesia sebagai penyumbang TB terbesar ketiga di dunia setelah India dan Cina dengan jumlah kasus baru sekitar 1.017.378,serta jumlah kematian sekitar 160.830 orang per tahun. Setiap tahunnya terdapat sekitar empat juta penderita baru tuberkulosis paru menular di dunia. Artinya, setiap tahun di dunia ini akan ada sekitar delapan juta penderita tuberkulosis paru dan akan ada sekitar tiga juta orang meninggal akibat penyakit ini. 490 ribu orang menderita MDR-TB di dunia pada tahun 2016, ditambah 110 ribu orang menderita TB resisten rifampisin (WHO, 2018). Estimasi prevalensi TB di Indonesia berdasarkan pemeriksaan mikroskopik BTA positif sebesar 148.5 per 100.000

2

orang. Survei Kesehatan Rumah Tangga (SKRT) tahun 1995 juga menyatakan bahwa penyakit TB sebagai penyebab kematian ketiga terbesar di Indonesia setelah penyakit kardiovaskuler dan penyakit saluran pernafasan serta penyakit nomor satu terbesar dalam kelompok penyakit infeksi (Maksum dkk, 2018). Berdasarkan latar belakang yang telah dipaparkan, maka apakah metode PCR dapat digunakan untuk mengidentifikasi Mycobacterium Tuberculosis. I.2 Tujuan 1. Untuk mengetahui cara pemeriksaan bakteri Mycobacterium Tuberculosis menggunaan metode molekuler (PCR) I.3 Manfaat 1. Mahasiswa dapat mengetahui cara pemeriksaan bakteri Mycobacterium Tuberculosis metode molekuler (PCR)

3

BAB II PEMBAHASAN II.1 Definisi PCR Polymerase

chain

reaction

(PCR)

merupakan

metode

untuk

mengamplifikasi asam nukleat dengan menggunakan perbedaan suhu untuk menggandakan DNA yang menjadi target. PCR digunakan sebagai alat yang digunakan untuk aplikasi non medis dan juga medis. Dalam aplikasi medis mikrobiologi, PCR digunakan sebagai diagnostik untuk mendeteksi atau mengkarakterisasi penyakit dari sampel spesimen pasien (Kurniati et al, 2019). PCR ini pertama kali dikembangkan pada tahun 1985 oleh Kary B. Mullis. Amplifikas

DNA

oligonukleotida

pada yang

PCR disebut

dapat

dicapai

amplimers.

bila

Primer

menggunakan DNA

suatu

primer sekuens

oligonukleotida pendek yang berfungsi mengawali sintesis rantai DNA. PCR memungkinkan dilakukannya pelipatgandaan suatu fragmen DNA. Umumnya primer yang digunakan pada PCR terdiri dari 20-30 nukleotida. DNA template (cetakan) yaitu fragmen DNA yang akan dilipatgandakan dan berasal dari patogen yang terdapat dalam spesimen klinik. Enzim DNA polimerase merupakan enzim

termostabil

Taq

dari

bakteri

termofilik

Thermus

aquaticus.

Deoksiribonukleotida trifosfat (dNTP) menempel pada ujung 3’ primer ketika proses pemanjangan dan ion magnesium menstimulasi aktivasi polymerase (Yusuf, 2010). Reaksi rantai polimerase sejauh ini merupakan metode yang sangat berguna untuk deteksi cepat DNA mikobakteri dalam spesimen klinis seperti dahak, lavage bronkial, cairan serebrospinal (CSF), dan cairan asites. Beberapa kelompok peneliti telah melaporkan penggunaan metode PCR, dengan variasi pada sensitifitas dan spesifisitasnya, hal ini mungkin dikarenakan perbedaan penyiapan sampel, serta metode PCR yang digunakan (Kurniati et al, 2019). II.2 Perkembangan Teknologi PCR Menurut (Bugi Ratno, 2015), Teknologi PCR selalu mengalami inovasi mengikuti dan menjawab kebutuhan-kebutuhan di bidang riset maupun diagnostik dan inovasi tersebut terjadi pada komponen “software” yaitu enzim dan komponen kimia pendukungnya, komponen “technique” yaitu metodologi PCR

4

dan komponen “hardware” yaitu mesin PCR. isolasi, kloning gen dan modifikasi dari enzim DNA polimerase. Sampai tahun 2013 saja sudah diketahui ada 19 jenis DNA polimerase baik type A maupun B dengan karakteristik unik hasil pengisolasiandari berbagai jenis thermotolerant bakteri (genus Themus, Thermoccocus, dan Pyrococcus) sehingga tidak heran dewasa ini persaingan untuk memunculkan DNA polimerase dengan fungsi unggul sangat digencar dilakukan oleh

berbagai peneliti

di dunia.

Pencarian mikroorganisme-

miroorganisme baru di ekosistem yang ekstrim serta modifikasi DNA polimeraseyang sudah ada dengan teknik mutagenesis dan rekayasa genetika merupakan bagian dari upaya untuk mendapatkan DNA polimerase terbarukan yang diharapkan memiliki aktivitas, spesifitas dan stabilitas tinggi sehingga bisa meningkatkan efisiensi PCR.

5

II. 3 Komponen PCR Menurut Yusuf, (2010) menjelasakan pada proses PCR diperlukan beberapa komponen utama adalah sebagai berikut: 1. DNA cetakan, yaitu fragmen DNA yang akan dilipatgandakan. DNA cetakan yang digunakan sebaiknya berkisar antara 105 – 106 molekul. Dua hal penting tentang cetakan adalah kemurnian dan kuantitas. 2. Oligonukleotida primer, yaitu suatu sekuen oligonukleotida pendek (18 – 28 basa nukleotida) yang digunakan untuk mengawali sintesis rantai DNA. Dan mempunyai kandungan G + C sebesar 50 – 60%. 3. Deoksiribonukelotida trifosfat (dNTP), terdiri dari dATP, dCTP, dGTP, dTTP. dNTP mengikat ion Mg2+ sehingga dapat mengubah konsentrasi efektif ion. Ini yang diperlukan untuk reaksi polimerasi.

6

4. Enzim DNA Polimerase, yaitu enzim yang melakukan katalisis reaksi sintesis rantai DNA. Enzim ini diperoleh dari Eubacterium yang disebut Thermus aquaticus, spesies ini diisolasi dari taman Yellowstone pada tahun 1969. Enzim polimerase taq tahan terhadap pemanasan berulang-ulang yang akan membantu melepaskan ikatan primer yang tidak tepat dan meluruskan wilayah yang mempunyai struktur sekunder. 5. Komponen pendukung lain adalah senyawa buffer. Larutan buffer PCR umumnya mengandung 10 – 50mM Tris-HCl pH 8,3-8,8 (suhu 20oC); 50 mM KCl; 0,1% gelatin atau BSA (Bovine Serum Albumin); Tween 20 sebanyak 0,01% atau dapat diganti dengan Triton X-100 sebanyak 0,1%; disamping itu perlu ditambahkan 1,5 mM MgCl2. Pada proses PCR menggunakan menggunakan alat termosiklus. Sebuah mesin yang memiliki kemampuan untuk memanaskan sekaligus mendinginkan tabung reaksi dan mengatur temperatur untuk tiap tahapan reaksi (Yusuf, 2010). II. 4 Tahapan Proses PCR Menurut Yusuf, (2010) menjelaskan tentang tahapan penting dalam proses PCR yang selalu terulang dalam 30- 40 siklus dan berlangsung dengan cepat, ada 3 tahapan adalah: 1. Denaturasi Di dalam proses PCR, denaturasi awal dilakukan sebelum enzim taq polimerase ditambahkan ke dalam tabung reaksi. Denaturasi DNA merupakan proses pembukaan DNA untai ganda menjadi DNA untai tunggal. Ini biasanya berlangsung sekitar 3 menit, untuk meyakinkan bahwa molekul DNA terdenaturasi menjadi DNA untai tunggal. Denaturasi yang tidak lengkap mengakibatkan DNA mengalami renaturasi (membentuk DNA untai ganda lagi) secara cepat, dan ini mengakibatkan gagalnya proses PCR. Adapun waktu denaturasi yang terlalu lama dapat mengurangi aktifitas enzim Taq polymerase. Aktifitas enzim tersebut mempunyai waktu paruh lebih dari 2 jam, 40 menit, 5 menit masing-masing pada suhu 92,5oC, 95oC dan 97,5oC. 2. Annealing (penempelan primer) Kriteria yang umum digunakan untuk merancang primer yang baik adalah bahwa primer sebaiknya berukuran 18 –

7

25 basa, mengandung 50 – 60 % G+C dan untuk kedua primer tersebut sebaiknya sama. Sekuens DNA dalam masing-masing primer itu sendiri juga sebaiknya tidak saling berkomplemen, karena hal ini akan mengakibatkan terbentuknya struktur sekunder pada primer tersebut dan mengurangi efisiensi PCR. Waktu annealing yang biasa digunakan dalam PCR adalah 30 – 45 detik. Semakin panjang ukuran primer, semakin tinggi temperaturnya. Kisaran temperatur penempelan yang digunakan adalah antara 36oC sampai dengan 72oC, namun suhu yang biasa dilakukan itu adalah antara 50 – 60oC. 3. Pemanjangan Primer (Extention) Selama tahap ini Taq polymerase memulai aktivitasnya memperpanjang DNA primer dari ujung 3’. Kecepatan penyusunan nukleotida oleh enzim tersebut pada suhu 72oC diperkirakan 35 – 100 nukleotida/detik, bergantung pada buffer, pH, konsentrasi garam dan molekul DNA target. Dengan demikian untuk produk PCR dengan panjang 2000 pasang basa, waktu 1 menit sudah lebih dari cukup untuk tahap perpanjangan primer ini. Biasanya di akhir siklus PCR waktu yang digunakan untuk tahap ini diperpanjang sampai 5 menit sehingga seluruh produk PCR diharapkan terbentuk DNA untai ganda.

8

Reaksi-reaksi tersebut di atas diulangi lagi dari 25 – 30 kali (siklus) sehingga pada akhir siklus akan diperoleh molekul-molekul DNA rantai ganda yang baru yang merupakan hasil polimerasi dalam jumlah yang jauh lebih banyak dibandingkan dengan jumlah DNA cetakan yang digunakan. Banyaknya siklus amplifikasi tergantung pada konsentrasi DNA target dalam campuran reaksi (Yusuf, 2010). Produk PCR dapat diidentifikasi melalui ukurannya dengan menggunakan elektroforesis gel agarosa. Metode ini terdiri atas menginjeksi DNA ke dalam gel agarosa dan menyatukan gel tersebut dengan listrik. Hasilnya untai DNA kecil pindah dengan cepat dan untai yang besar diantara gel menunjukkan hasil positif (Yusuf, 2010).

II. 5 Kelebihan dan Kekurangan Metode PCR Keunggulan PCR dikatakan sangat tinggi. Hal ini didasarkan atas spesifitas,

efisiensi

dan

keakuratannya.

Spesifitas

PCR

terletak

pada

kemampuannya mengamplifikasi sehingga menghasilkan produk melalui

9

sejumlah siklus. Keakuratan yang tinggi karena DNA polymerase mampu menghindari kesalahan pada amplifikasi produk. Masalah yang berkenaan dengan PCR yaitu biaya PCR yang masih tergolong tinggi (Yusuf, 2010). Selain itu kelebihan lain metode PCR dapat diperoleh pelipatgandaan suatu fragmen DNA (110 bp, 5×10-9 mol) sebasar 200.00 kali setelah dilakukan 20 siklus reaksi selama 220 menit. Reaksi ini dilakukan dengan menggunakan komponen dalam jumlah sangat sedikit, DNA cetakan yang diperlukan hanya sekitar 5 μg oligonukleotida yang diperlukan hanya sekitar 1 mM dari reaski ini biasa dilakukan dalam volume 50-100 μl. DNA cetakan yang digunakan juga tidak perlu dimurnikan terlebih dahulu sehingga metode PCR dapat digunakan untuk melipatgandakan suatu sekuen DNA dalam genom bakteri hanya dengan mencampukan kultur bakteri di dalam tabung PCR (Yusuf, 2010). II. 5 Jenis-Jenis PCR Menurut Yusuf, (2010) menjelaskan tentang modifikasi teknik PCR adalah sebagai berikut: 1. Restriction Fragment Length Polymorphism (RFLP) Metode ini digunakan untuk membedakan organisme berdasarkan analisis model derifat dari perbedaan DNA. 2. Inverse-PCR Metode ini digunakan ketika hanya satu sekuen internal yang diketahui. Template didigesti dengan enzim restriksi yang memotong bagian luar daerah yang akan diamplifikasi, fragmen restriksi yang dihasilkan ditempelkan dengan ligasi dan diamplifikasi dengan menggunakan sekuen primer yang memiliki titik ujung yang memiliki jarak yang jauh satu sama lain dengan segmen eksternal yang telah tergabung. Metode ini khusus digunakan untuk mengidentifikasi ”sekuen antara” dari beragam gen. 3. Nested-PCR Proses ini memungkinkan untuk mengurangi kontaminasi pada produk selama amplifikasi dari penyatuan primer yang tidak diperlukan. Dua set primer digunakan untuk mendukung metode ini, set kedua mengamplifikasi target kedua selama proses pertama berlangsung. Sekuens DNA target dari

10

satu set primer yang disebut primer inner disimpan di antara sekuens target set kedua dari primer yang disebut sebagai outer primer. Pada prakteknya, reaksi pertama dari PCR menggunakan outer primer, lalu reaksi PCR kedua dilakukan dengan inner primer atau nested primer menggunakan hasil dari produk reaksi yang pertama sebagai target amplifikasi. Nested primer akan menyatu dengan produk PCR yang pertama dan menghasilkan produk yang lebih pendek daripada produk yang pertama. 4. Quantitative-PCR Digunakan untuk pengukuran berulang dari hasil produk PCR. Metode ini secara tidak langsung digunakan untuk mengukur kuantitas, dimulai dari jumlah DNA, cDNA, atau RNA. Hasil dari metode ini juga menampilkan copy dari sampel. 5. Reverse Transcriptase (RT-PCR) Metode ini digunakan untuk amplifikasi, isolasi atau identifikasi sekuen dari sel atau jaringan RNA. Metode ini dibantu oleh reverse transcriptase (mengubah RNA menjadi cDNA), mencakup pemetaan, menggambarkan kapan dan dimana gen diekspresikan. 6. Random Amplified Polymorphic DNA (RAPD) bertujuan untuk mendeteksi polimorfisme pada tingkat DNA. Metode ini dikembangkan oleh Welsh and Mc Clelland (1990) dengan cara mengkombinasikan teknik PCR menggunakan primer – primer dengan sequens acak untuk keperluan amplifikasi lokus acak dari genom. II.7 Optimasi PCR Menurut (Darmo dan Ari, 2001), Untuk mendapatkan hasil PCR yang optimal perlu dilakukan optimasi proses PCR. Secara umum optimasi proses PCR dapat dilakukan dengan cara memvariasikan kondisi yang digunakan pada proses PCR tersebut. Optimasi kondisi berkaitan erat dengan faktor-faktor seperti jenis polimerase DNA; suhu; konsentrasi, dalam hal ini berkaitan dengan dNTPs, MgCl2 dan DNA polimerase; buffer PCR dan waktu.

11

Menurut (Iman Permana, dkk. 2017), Suhu dan siklus PCR merupakan salah satu persyaratan PCR yang harus dipenuhi agar reaksi PCR berjalan dengan baik. Suhu dan siklus PCR terdiri atas: a. Suhu

denturasi;

banyak

kegagalan

dalam

PCR

disebabkan

tidak

sempurnanya denaturasi templat. Umumnya kondisi denaturasi adalah 95°C selama 30 detik atau 97°C selama 15 detik. Tetapi suhu yang lebih tinggi mungkin juga cocok pada target DNA yang mempunyai G+C mol% yang sangat tinggi. Tidak sempurnanya denaturasi dapat menyebabkan putusnya untai DNA, dan tahap denaturasi yang terlalu lama menyebabkan hilangnya aktivitas enzim DNA polimerase. Waktu paruh enzim Taq polimerase adalah lebih dari 2 jam pada suhu 92,5°C, atau 40 menit pada 95°C dan 5 menit pada 97°C. b. Suhu annealing atau penggabungan primer. Suhu penggabungan templat dengan primer berbeda menurut urutan basa yang digunakan. Pengaturan suhu penggabungan sangat penting guna mencegah terjadinya pita elektroforesis yang tidak spesifik. Untuk menentukan suhu annealing dapat digunakan rumus dibawah ini: Tm = 4° (G + C) + 2° (A + T) °C. Jika Tm >25 nukleotida dengan Pendekatan beberapa software: DNAstar, Perlprimer, oligoexplorer dan Fast PCR. c. Suhu perpanjangan. Reaksi Taq polimerase pada suhu 70°C dilaporkan dapat maju dengan kecepatan 60 nukleotida /detik/ molekul, dengan suhu 72°C selama 1 menit akan dapat memperbanyak 1 kb, suatu perhitungan yang diperkirakan aman. d. Siklus reaksi. Menurut teori dengan jumlah siklus n kali akan menghasilkan 2n perbanyakan. Tetapi Taq polimerase, konsentrasi DNA sampel maupun primer menjadi faktor yang sangat berpengaruh dalam reaksi, sehingga hanya didapat hasil yang lebih rendah dari perhitungan. Oleh karena itu, selalu dilakukan siklus sebanyak 25-35 kali. Penambahan siklus yang tidak perlu akan menyebabkan DNA non spesifik menjadi lebih banyak. Menurut (Iman Permana, dkk. 2017), Selain itu yang menjadi persyaratan utama dalam PCR antara lain meliputi:

12

1. DNA templat; setelah ditemukannya PCR, cara ekstrasi DNA genom banyak dimodifikasi. Yang perlu dihindarkan adalah adanya inhibitor seperti besi dalam darah, kontaminan DNA oleh fenol, RNA, protein, ataupun DNA lain, karena “cross contaminan” sangat mudah terjadi dalam PCR. Selain itu keutuhan DNA templat harus dijaga dari fragmentasi oleh enzim nuklease. 2. Primer; primer dapat dibuat dengan alat DNA synthesizer. Secara umum halhal yang perlu diperhatikan dalam pemilihan primer antara lain adalah: Konsentrasi optimal dari dari primer yang dipersyaratkan dalam reaksi adalah antara 0,1-0,4 μM. konsentrasi yang tinggi akan mengakibatkan kesalahan menempel sehingga mensintesis produk yang tidak diinginkan. 3. dNTP; sebagai monomer/pembangun DNA, terdiri dari empat senyawa yaitu dATP, dGTP, dTTP, dan dCTP. Keseimbangan campuran dNTP sangat penting dengan konsentrasi 0,1 – 0,4 μM, karena jika konsentasi keempat senyawa tersebut tidak sesuai maka akan mengurangi kemampuan kinerja enzim Taq DNA polimerase. Untuk menghindari kesalahan membaca nukleotida, sebaiknya konsentrasi substrat ini divariasikan antara 20-200 μM. 4. Taq DNA polimerase; pada permulaan ditemukannya PCR, Menurut Saiki et al. pada tahun (1985) menggunakan DNA polimerase yang disebut enzim Klenow yang diisolasi dari bakteri Escherichia coli. Enzim ini tidak aktif pada suhu tinggi, maka tiap siklus reaksi reaksi harus ditambahkan enzim ini lagi. Sekarang telah dikembangkan DNA polimerase yang tahan terhadap suhu tinggi, yang diisolasi dari bakteri termofilik Thermus aquaticus. DNA polymerase yang kemudian terkenal dengan sebutan Taq polimerase ini dapat aktif hingga suhu 94-95 °C. 5. Bufer PCR; bekerjanya enzim Taq polimerase memerlukan bufer yang biasanya terdiri atas: a. trisHCl dengan konsentrasi optimalnya adalah 10-50 mM, pH 8,3-8,4, sesuai dengan pH optimal dari enzim Taq polimerase. b. KCl diperlukan karena mempengaruhi kinerja enzim, dan konsentrasi optimumnya adalah 50 mM. Konsentrasi KCl di atas 75 mM dapat menghambat kerja enzim.

13

c. Gelatin adalah senyawa yang perlu ditambahkan untuk menstabilkan enzim Taq polimerase. Gelatin dapat diganti dengan Bovine serum Albumin ataupun deterjen non-ionik seperti Tween 20, yang ditambahkan setelah sterilisasi. 6. MgCl2; konsentrasi MgCl2 yang optimal bervariasi antara 0,5-5 mM. Menurut Saiki et al. (1985), konsentrasi optimum dari MgCl2 berubah menurut primer yang digunakan. Karena dNTP juga berikatan dengan Mg2+ yang efektif sangat tergantung pula pada konsentrasi dNTP. II. 8 Metode Kerja Menurut (Raisuli Ramadhan, dkk. 2017), Deteksi Mycobacterium tuberculosis pada sputum dapat dilakukan secara teknik Polymerase Chain Reaction (PCR), pemeriksaan mikroskopik, dan kultur bakteri. Pemeriksaan mikroskopis dahak adalah komponen kunci dalam program penanggulangan TB untuk menegakkan diagnosis, evaluasi dan tindak lanjut pengobatan dari pemeriksaan spesimen dahak sewaktu pagi sewaktu (SPS). Pemeriksaan dahak secara mikroskopis merupakan pemeriksaan yang paling mudah, murah, efisien, spesifik dan dapat dilaksanakan di semua unit laboratorium. Deteksi kuman TBC dengan teknik PCR mempunyai sensitivitas yang amat tinggi. PCR merupakan cara amplifikasi DNA, dalam hal ini DNA Mycobacterium tuberculosis, secara in vitro. Proses ini memerlukan DNA cetakan (template) untai ganda yang mengandung DNA target, enzim DNA polymerase, nukleotida trifosfat, dan sepasang primer. 1. Identifikasi pemeriksaan Mycobacterium tuberculosis menggunakan metode GeneXpert dan Multiplex PCR PCR GeneXpert didasarkan pada amplifikasi berulang dari target DNA dan kemudian dideteksi secara fluorimetrik. Teknik ini dapat mengidentifikasi genrpo BM dan urutannya. Proses ini memerlukan DNA cetakan (template) untai ganda yang mengandung DNA target, enzim DNA polymerase, nukleotida trifosfat, dan sepasang primer (Susilawati dkk, 2019). Primer yang digunakan yaitu primer Pt8 dan Pt9 untuk mendeteksi gen IS6110. IS6110 adalah daerah target amplifikasi dengan menggunakan primer Pt8 dan Pt9. Primer ini mempunyai sensitivitas cukup tinggi untuk

14

mendeteksi MTB complex dengan fragmen/pita DNA berukuran 541 bp (base pair). Metode PCR menggunakan primer oligonukleotida Pt8 dan Pt9 pada isolat klinis Mycobacterium tuberculosis mempunyai kemampuan mendeteksi jumlah DNA sebesar 100 pg yang setara dengan 20 sel bakteri (Susilawati dkk, 2019). Untuk mendeteksi adanya resistensi bagian gen yang conserved dari urutan DNA bakteri Mycobacterium tuberculosis digunakan primer rpoB dan katG, penggunaan primer ini dikarenakan spesifik untuk mendeteksi resistensi obat karena adanya mutasi. Gen katG dan inhA digunakan untuk mendeteksi kasus resistensi isoniazid. rpoB untuk mendeteksi kasus resistensi rifampisin. Sedangkan kasus resistensi terhadap isoniazid dan rifampisin sekaligus (MDR-TB) berhubungan dengan adanya mutasi pada gen inhA, katG, dan rpoB secara serentak (Susilawati dkk, 2019). Kelebihan dari teknik Multiplex PCR ini adalah dalam satu kali proses reaksi dapat mendeteksi banyak patogen sekaligus. Multiplex PCR dapat mempercepat proses diagnosis sehingga waktu proses identifikasi yang diperlukan sekitar ±2,5 jam, teknik ini ekonomis karena tidak memerlukan konversi dari uji-uji lain, sensitivitas hasil analisis dengan akurasi tinggi (>95%) dan ramah lingkungan karena tidak menggunakan bahan radioaktif berbahaya (Susilawati dkk, 2019). Kekurangan dari metode Multiplex PCR (mPCR) yaitu: Spesifisitas, efisiensi, dan sensitivitas amplifikasi dipengaruhi oleh beberapa faktor. Salah satu faktor yang memengaruhi adalah suhu annealing. Suhu annealing adalah suhu yang diperlukan untuk primer berhasil menempel pada DNA target. Suhu annealing yang terlalu rendah dari suhu optimum, maka akan menyebabkan terjadinya false priming, dan jika suhu annealing lebih tinggi dari suhu optimumnya, maka primer tidak dapat menempel pada DNA target sehingga proses PCR tidak berhasil (Susilawati dkk, 2019). Berikut ini adalah tahapan identifikasi Mycobacterium tuberculosis menggunakan metode GeneXpert dan Multiplex PCR menurut Susilawati dkk, (2019):

15

a. Isolasi DNA Mycobacterium tuberculosis Pada Sputum Sputum dalam tabung 1,5 mL ditambahkan 200 µL GST buffer dan 20 µL proteinase K kedalam endapan divortex dan diinkubasi pada suhu 60oC selama 30 menit selama inkubasi divortex tiap 5 menit. Kemudian 200 µL GSB buffer dimasukkan kedalam tabung dan divortex selanjutnya diinkubasi pada suhu 60oC selama 20 menit selama inkubasi di vortex tiap 5 menit. Ditambahkan 200 µL etanol absolute dan divortex selama 10 detik. Selanjutnya disiapkan tabung GS dalam koleksi kemudian dipindahkan campuran pada tabung GS kemudian dilakukan sentrifugasi pada kecepatan 14.000 rpm selama 1 menit. Kemudian cairan dalam tabung koleksi dibuang dan tabung koleksi dipasang kembali. Lalu 400 µL W1 buffer ditambahkan kedalam tabung GS kemudian dilakukan sentrifugasi pada kecepatan 12.000 rpm selama 1 menit. Selanjutnya GS coloumb dipindahkan pada tabung koleksi baru lalu 600 µL wash buffer + etanol ditambahkan kedalam GS coloumb kemudian di sentrifugasi pada kecepatan 12.000 rpm selama 1 menit. Selanjutnya tabung GS dipindahkan pada tabung koleksi baru lalu dilakukan sentrifugasi pada kecepatan 12.000 rpm selama 2 menit dalam keadaan kering.Selanjutnya GS coloumb dan ditransfer pada tabung 1,5 mL steril lalu 100 µL elution buffer dimasukan kedalam GS coloumb dan dilakukan sentrifugasi pada kecepatan 12.000 rpm selama 1 menit. b. Amplifikasi DNA Amplifikasi DNA dilakukan dengan metode PCR menggunakan primer oligonukleotida

Pt8

(5’GTGCGGATGGTCGCGAGAT-3’)

dan

Pt9

(5’CTGGATGCCCTCACGGTTCA3’). Primer katG (5’CCC GAG CAA CAC CCA CCC ATT ACA GAAA C-3’). Dan primer rpoB (5’GGT TCG CCG CGC TGG CGC. GAA T-3’). Reaksi PCR dilakukan dalam campuran reaksi 25µL yang terdiri dari 12,5 µL master mix, 0,5 µL masing-masing primer, aquabides 5,5 µL dan 5 µL DNA template. Siklus yang digunakan sebanyak 35 siklus yang diawali dengan pra-denaturasi pada suhu 94° C selama 5 menit, denaturasi pada suhu 94° C selama 20 detik, annealing

16

pada suhu 56° C selama 20 detik, dan extention pada suhu 72° C selama 30 detik dan extention akhir pada suhu 72° C selama 10 menit. c. Elektroforesis Posisi Baki diatur dan buffer 1X TAE pH 8 500 mL dituang kedalam tangki elektroforesis. Sebanyak 6 µL produk PCR dimasukan kedalam sumur gel agarosa, voltase arus dan waktu running diatur 80 V, 1 A dan 30 menit.Setelah elektroforesis selesai, gel diletakan didalam gel UV transiluminator selanjutnya diamati pita DNA yang tervisualisasi. 2. Identifikasi Bakteri menggunakan Metode Real Time Polymerase Chain Reaction Assay (RT-PCR) dalam Cartridge GeneXpert MTB/RIF Sekali Pakai Diagnosis TB berdasarkan pemeriksaan molekuler yang menggunakan metode Real Time Polymerase Chain Reaction Assay (RT-PCR) semi kuantitatif yang menargetkan wilayah hotspot gen rpoB pada Mycobacterium tuberculosis, yang terintegrasi dan secara otomatis mengolah sediaan dengan ekstraksi deoxyribo nucleic acid (DNA) dalam cartridge sekali pakai. Penelitian invitro menunjukkan batas deteksi bakteri TB dengan metode RTPCR

GeneXpert

minimal

131

bakteri/mL

sputum.

Waktu

hingga

didapatkannya hasil kurang dari dua jam dan hanya membutuhkan pelatihan yang simpel untuk dapat menggunakan alat ini (Naim dkk, 2018). pemeriksaan Genxpert dengan pemeriksaan Xpert MTB/RIF. Metode ini merupakan uji cepat (rapid test) (Sumual dkk, 2017). Tes cepat molekuler ini dilakukan dengan cara spesimen sputum yang sudah dikumpulkan dan dimasukkan kedalam wadah, kemudian ditambahkan buffer setelah itu diinkubasi selama 15 menit lalu diambil dengan pipet khusus dan dimasukkan kedalam cartridge, setelah itu dimasukkan kedalam alat GeneXpert MTB/RIF. Sputum diproses dan diperiksa oleh GeneXpert MTB/RIF secara otomatis, hasilnya diperoleh setelah ± 2 jam (Naim dkk, 2018). 3. Identifikasi Mycobacterium tuberculosis menggunakan Teknik LoopMediated Isothermal Amplification (LAMP-TB)

17

Loop-Mediated Isothermal Amplification (LAMP) merupakan suatu metode uji diagnostik molekular yang diperkenalkan di Jepang sejak tahun 1999 untuk mendeteksi penyakit infeksius seperti TB. Selain memiliki sensitivitas, spesifitas dan efisiensi tinggi, metode LAMP-TB juga cepat dan sederhana dalam hal teknik molekular untuk mengidentifikasi beberapa penyakit, salah satunya ialah TB. Metode LAMP menggunakan amplifikasi DNA pada suhu tetap, sehingga penggunaan alat thermocycler yang mahal tidak diperlukan. Kegagalan proses amplifikasi pada metode LAMP dapat diatasi dengan menambahkan enzim yang dapat menjadi substrat selama proses reaksi amplifikasi berlangsung. Sistem deteksi pada teknik ini juga sederhana karena produk DNA yang akan dideteksi dapat berupa endapan atau perubahan warna/fluoresensi. Interpretasi hasil dapat dilakukan secara sederhana yaitu dengan menggunakan mata telanjang atau sinar UV sederhana (Sumual dkk, 2017). Menurut WHO metode LAMP-TB memiliki sensitivitas 15% lebih tinggi daripada pemeriksaan BTA (78% dengan 63%). Penelitian terakhir menemukan bahwa spesifitas dan sensitivitas metode LAMP lebih tinggi dari pada pemeriksaan Ziehl Neelsen khususnya yang telah dinyatakan negatif, dan mendapatkan hasil positif untuk 16 sampel yang dinyatakan negatif pada pewarnaan Ziehl Neelsen (Sumual dkk, 2017). Alat dan bahan yang digunakan yaitu sampel sputum, kontrol positif, kontrol negatif, reagen ekstraksi, reagen amplifikasi, waterbath, inkubator, micro-tube, lampu fluoresens/sinar UV. Selanjutnya pada sampel sputum dilakukan pemeriksaan LAMP-TB (Sumual dkk, 2017).

18

Gambar 3. Hasil pemeriksaan LAMP-TB menggunakan sinar fluoresens Metode LAMP adalah metode uji diagnostik molekuler cara langsung berdasarkan uji identifikasi asam nukleat bakteri dan merupakan metode modifikasi amplifikasi PCR pada suhu tetap dengan menggunakan 4-6 pasang primer dari gen yang dapat mengidentifikasi sekuens DNA bakteri. Metode LAMP-TB relatif tidak sensitif terhadap akumulasi DNA dan produk sampingan DNA (garam pirofosfat), sehingga reaksi berlangsung sampai sejumlah besar produk DNA (amplikon) dihasilkan. Fitur ini membuat deteksi yang terlihat dari amplifikasi yang berhasil dilakukan dengan menggunakan dsDNAbinding dyes seperti SYBR green, dengan mendeteksi kekeruhan yang disebabkan oleh pengendapan magnesium pirofosfat, atau dengan menggunakan pereaksi fluoresensi non-inhibitor. Hasilnya dapat dilihat secara visual dibawah sinar ultraviolet atau lampu fluoresens dengan menggunakan mata telanjang dan metode ini hanya berlangsung